| AnalyteName | AnalyteDescr |
| 6-Pack Ring | 6-Pack Ring |
| 6PPD-quinone | 6PPD-quinone (N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine-quinone) |
| 6PPD-quinone-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: 6PPD-quinone-13C6 |
| Abnormality | Abnormality (%) |
| Abundance | Abundance |
| AccesstoWaterbody_BikePath | AccesstoWaterbody_BikePath |
| AccesstoWaterbody_Fence | AccesstoWaterbody_Fence |
| AccesstoWaterbody_HeavyVegetation | AccesstoWaterbody_HeavyVegetation |
| AccesstoWaterbody_ParkingLot | AccesstoWaterbody_ParkingLot |
| AccesstoWaterbody_PicnicArea | AccesstoWaterbody_PicnicArea |
| AccesstoWaterbody_RestrictedAccessMaintenanceRoad | AccesstoWaterbody_RestrictedAccessMaintenanceRoad |
| AccesstoWaterbody_Roadway | AccesstoWaterbody_Roadway |
| AccesstoWaterbody_Walkway | AccesstoWaterbody_Walkway |
| Accumulation | Accumulation using Trash Protocol |
| Acenaphthene | Acenaphthene |
| Acenaphthene-d10(Surrogate) | Surrogate: Acenaphthene-d10 |
| Acenaphthylene | Acenaphthylene |
| Acenaphthylene-d10(Surrogate) | Surrogate: Acenaphthylene-d10 |
| Acetaldehyde | Acetaldehyde (Ethanal) |
| Acetaminophen | Acetaminophen |
| Acetamiprid | Acetamiprid |
| Acetamiprid-d3(Surrogate) | Surrogate: Acetamiprid-d3 |
| Acetone | Acetone |
| Acid Mine Drainage Extent | Acid Mine Drainage Extent |
| Acid Mine Drainage Intensity | Acid Mine Drainage Intensity |
| Acid Mine Drainage Proximity | Acid Mine Drainage Proximity |
| Acid Neutralizing Capacity | Acid Neutralizing Capacity (ANC) |
| Acid Volatile Sulfides | Acid Volatile Sulfides (AVS) |
| Acifluorfen | Acifluorfen |
| Acrolein | Acrolein |
| Acrylonitrile | Acrylonitrile |
| Actinemys pallida (SWPT) | Actinemys pallida, Assay name: SWPT, 5’ CCATCCCTACTACTACTTCTAGC 3’, 5’ GGCTAAGTTTCCGGCTAATG 3’, 5FAM-TGCCCCTGCTTCGATTCCTGAT-3IABkFQ |
| Adsorbable Organic Fluorine | Adsorbable Organic Fluorine (AOF) [detected as Fluoride] |
| Aesthetic Condition | Aesthetic Condition |
| AFDM_Algae | Ash Free Dry Mass primarily of Algae but other items may be weighed |
| Age | Age |
| Age_Pond | Age (in years) of the pond if it is created |
| Agricultural Other Extent | Agricultural Other Extent |
| Agricultural Other Intensity | Agricultural Other Intensity |
| Agricultural Other Proximity | Agricultural Other Proximity |
| Agricultural Runoff Extent | Agricultural Runoff Extent |
| Agricultural Runoff Intensity | Agricultural Runoff Intensity |
| Agricultural Runoff Proximity | Agricultural Runoff Proximity |
| Air Traffic Extent | Air Traffic Extent |
| Air Traffic Intensity | Air Traffic Intensity |
| Air Traffic Proximity | Air Traffic Proximity |
| Alachlor | Alachlor (Lasso) |
| Aldicarb | Aldicarb |
| Aldicarb Sulfone | Aldicarb Sulfone |
| Aldicarb Sulfoxide | Aldicarb Sulfoxide |
| Aldrin | Aldrin |
| Aldrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Aldrin-13C12 |
| Algae | Algae for benthics |
| Algae Cover | Percent of stream's water surface upstream of sample location estimated to be covered with algae |
| Algae-attached | Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached |
| Algae-floating Mats | Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats |
| Algal/Surface Mats/Benthic Algal Growth Extent | Algal/Surface Mats/Benthic Algal Growth Extent |
| Algal/Surface Mats/Benthic Algal Growth Intensity | Algal/Surface Mats/Benthic Algal Growth Intensity |
| Algal/Surface Mats/Benthic Algal Growth Proximity | Algal/Surface Mats/Benthic Algal Growth Proximity |
| Alkalinity as CaCO3 | Alkalinity as CaCO3 |
| Allethrin | Allethrin |
| Allyl Chloride | Allyl Chloride (3-Chloropropene) |
| Alpha Linolenic Acid | Alpha Linolenic Acid |
| Aluminum | Aluminum |
| Aluminum Foil | Aluminum Foil |
| Aluminum, Organic Monomeric | Organic Monomeric Aluminum (Organic Reactive) |
| Aluminum, Total Monomeric | Total Monomeric Aluminum (Organic + Inorganic Reactive) |
| Aluminum/Steel Can | Aluminum/Steel Can |
| Ametryn | Ametryn |
| Aminocarb | Aminocarb |
| Aminomethyl Phosphonic Acid | Aminomethyl Phosphonic Acid (AMPA) |
| Ammonia as N | Ammonia as N |
| Ammonia as N, Unionized | Unionized Ammonia as N |
| Ammonia as NH3 | Ammonia as NH3 |
| Ammonia as NH3, Unionized | Unionized Ammonia as NH3 |
| Ammonium as N | Ammonium as N (NH4) |
| AMPA(Surrogate) | Surrogate: Aminomethyl Phosphonic Acid (AMPA) |
| Anatoxin-A | Anatoxin-A |
| Anatoxin-a gene, Prokaryotic DNA (anaC) | Anatoxin-a gene Prokaryotic DNA, Target Gene: anaC, Proprietary primer sequences from Bend Genetics LLC |
| Anaxyrus californicus (AroT) | Anaxyrus californicus, Assay name: AroT, 5’ CACCAAACTAACTAACTTCTTT 3’, 5’ CATTAGGTATTTCATCATTCCC 3’, 5FAM-AATTTATTGGAGCTATAATGATAGTACCGT-3IABkFQ |
| Angling Pressure | Angling Pressure |
| Anilazine | Anilazine |
| Animal Burrows Extent | Animal Burrows Extent |
| Animal Burrows Intensity | Animal Burrows Intensity |
| Animal Burrows Proximity | Animal Burrows Proximity |
| AnimalPresence | describes presence of animals which may include tracks, scat, sounds or physical presence |
| Antennal segment | Antennal segment (#) |
| Anthracene | Anthracene |
| Antimony | Antimony |
| Appliance | Appliance |
| AquaticLife | AquaticLife using Trash Protocol |
| Arachidonic | Arachidonic |
| Area | Area |
| Arsenic | Arsenic |
| Arsenic, Inorganic | Inorganic Arsenic |
| Asbestos, Total | Total Asbestos |
| ASCI_D | Score for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_pct_att | Percent of taxa attributed with tolerance value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_pred | Count of most tolerant algae taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_raw | Count of most tolerant algae taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_scr | Count of most tolerant algae taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_pct_att | Percent of taxa attributed with genus (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_pred | Richness of Epithemia and Rhopalodia taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_raw | Richness of Epithemia and Rhopalodia taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_scr | Richness of Epithemia and Rhopalodia taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_NumberTaxa | Number of diatom taxa |
| ASCI_D_prop.spp.IndicatorClass_TN_low_pct_att | Percent of taxa attributed with nitrogen indicator value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.IndicatorClass_TN_low_pred | Proportion low total nitrogen indicator taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.IndicatorClass_TN_low_raw | Proportion low total nitrogen indicator taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.IndicatorClass_TN_low_scr | Proportion low total nitrogen indicator taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_pct_att | Percent of taxa attributed with habitat value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_pred | Proportion planktonic taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_raw | Proportion planktonic taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_scr | Proportion planktonic taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_pct_att | Percent of taxa attributed with trophic indicator value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_pred | Proportion eutrophic taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_raw | Proportion eutrophic taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_scr | Proportion eutrophic taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_pct_att | Percent of taxa attributed with salinity value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_pred | Richness of brackish/freshwater taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_raw | Richness of brackish/freshwater taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_scr | Richness of brackish/freshwater taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_ValveCount | Total number of diatom valves reported in the input data (i.e., sum of BAResult) |
| ASCI_H | Score for the Hybrid (diatom and soft-bodied algae) Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_pct_att | Percent of taxa attributed phosphorus indicator value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_pred | Count of high total phosphorus indicator taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_raw | Count of high total phosphorus indicator taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_scr | Count of high total phosphorus indicator taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_pct_att | Percent of taxa attributed with tolerance value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_pred | Count of most tolerant algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_raw | Count of most tolerant algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_scr | Count of most tolerant algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_pct_att | Percent of taxa attributed with genus (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_pred | Richness of Epithemia and Rhopalodia taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_raw | Richness of Epithemia and Rhopalodia taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_scr | Richness of Epithemia and Rhopalodia taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_NumberTaxa | Number of diatom taxa + soft-bodied algae taxa in Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_pct_att | Percent of taxa attributed with oxygen tolerance value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_pred | Richness of algae species with 30% oxygen tolerance (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_raw | Richness of algae species with 30% oxygen tolerance (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_scr | Richness of algae species with 30% oxygen tolerance (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_pct_att | Percent of taxa attributed with habitat value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_pred | Proportion planktonic algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_raw | Proportion planktonic algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_scr | Proportion planktonic algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_pct_att | Percent of taxa attributed with trophic indicator value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_pred | Proportion eutrophic algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_raw | Proportion eutrophic algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_scr | Proportion eutrophic algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.ZHR_pct_att | Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.ZHR_raw | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) |
| ASCI_H_prop.spp.ZHR_scr | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_pct_att | Percent of taxa attributed with salinity value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_pred | Richness of brackish/freshwater algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_raw | Richness of brackish/freshwater algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_scr | Richness of brackish/freshwater algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_S | Score for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_Biovolume | Total soft-bodied algae biovolume reported in the input data (i.e., sum of Result) |
| ASCI_S_EntityCount | Total number of soft-bodied algae entities reported in the input data (i.e., sum of BAResult) |
| ASCI_S_NumberTaxa | Number of soft-bodied algae taxa |
| ASCI_S_prop.spp.IndicatorClass_DOC_high_pct_att | Percent of taxa attributed with dissolved organic carbon indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_DOC_high_raw | Proportion high dissolved organic carbon indicator Algal species (raw) |
| ASCI_S_prop.spp.IndicatorClass_DOC_high_scr | Proportion high dissolved organic carbon indicator Algal species (score) for the Soft-bodied Agae Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_NonRef_pct_att | Percent of taxa attributed with reference/non-reference indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_NonRef_raw | Proportion non-reference indicator algae species (raw) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_NonRef_scr | Proportion non-reference indicator algae species (score) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_TP_high_pct_att | Percent of taxa attributed phosphorus indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_TP_high_raw | Proportion high total phosphorus indicator algae taxa (raw) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_TP_high_scr | Proportion high total phosphorus indicator Algal taxa (score) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.ZHR_pct_att | Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.ZHR_raw | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.ZHR_scr | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Soft-bodied Algal Stream Condition Index |
| Aspon | Aspon |
| AssemblageIDAlgaeSampleVolume | Volume of material and liquid to produce the soft algae assemblage (taxonomy) sample |
| AssemblageIDDiatomSampleVolume | Volume of material and liquid to produce the diatom assemblage (taxonomy) sample |
| Atraton | Atraton |
| Atrazine | Atrazine |
| Atrazine-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Atrazine-13C3 |
| Atrazine-13C3(Surrogate) | Surrogate: Atrazine-13C3 |
| Atrazine-d5(Surrogate) | Surrogate: Atrazine-d5 |
| Atrazine-Desisopropyl-2-Hydroxy | Atrazine-Desisopropyl-2-Hydroxy |
| ATVs Extent | ATVs Extent |
| ATVs Intensity | ATVs Intensity |
| ATVs Proximity | ATVs Proximity |
| Autopart | Autopart |
| Avoidance | Avoidance (%) |
| Azinphos Ethyl | Azinphos Ethyl |
| Azinphos Methyl | Azinphos Methyl (Guthion) |
| Azinphos-Methyl-d6(IsoDilAnalogue) | Isotope Dilution Analogue: Azinphos-Methyl-d6 |
| Azoxystrobin | Azoxystrobin |
| Back Water | Back Water present |
| Bacteroidales, Avian (LeeSeaGull) | Avian Bacteroidales, Assay name: LeeSeaGull, 5’ AGGTGCTAATACCGCATAATACAGAG 3’, 5’ GCCGTTACCTCACCGTCTA 3’ |
| Bacteroidales, Canine (BacCan) | Canine Bacteroidales, Assay name: BacCan, 5' GGAGCGCAGACGGGTTTT 3', 5' CAATCGGAGTTCTTCGTGATATCTA 3' |
| Bacteroidales, Canine (DG3) | Canine Bacteroidales, Assay name: DG3, 5' TTTTCAGCCCCGTTGTTTCG 3' , 5' TGAGCGGGCATGGTCATATT 3' |
| Bacteroidales, Cow (BacCow) | Cow Bacteroidales, Assay name: BacCow, 5' CCAACYTTCCCGWTACTC 3', 5' GGACCGTGTCTCAGTTCCAGTG 3' |
| Bacteroidales, Cow (CowM2) | Cow Bacteroidales, Assay name: CowM2, 5' CGGCCAAATACTCCTGATCGT 3', 5' GCTTGTTGCGTTCCTTGAGATAAT 3' |
| Bacteroidales, Horse (HoF597F) | Horse Bacteroidales, Assay name: HoF597F, 5' CCAGCCGTAAAATAGTCGG 3', 5' CAATCGGAGTTCTTCGTG 3' |
| Bacteroidales, Human (HF183/BacR287) | Human Bacteroidales, Assay name: HF183/BacR287, 5' ATCATGAGTTCACATGTCCG 3, 5'-CTTCCTCTCAGAACCCCTATCC 3' |
| Bacteroidales, Human (HF183/BFDrev) | Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3' |
| Bacteroidales, Human (HF183TMCaMan) | Human Bacteroidales, Assay name: HF183TMCaMan, 5’ ATCATGAGTTCACATGTCCG 3’, 5’ CTTCCTCTCAGAACCCCTATCC 3’ |
| Bacteroidales, Ruminant (Rum2Bac) | Ruminant Bacteroidales, Asssay name: Rum2Bac, 5' ACAGCCCGCGATTGATACTGGTAA 3', 5' CAATCGGAGTTCTTCGTGAT 3' |
| Bag, Large/Retail | Bag, Large/Retail |
| Bag, Pet Waste | Bag, Pet Waste |
| Bag, Single Use Plastic | Bag, Single Use Plastic |
| Bag, Takeout | Bag, Takeout |
| Bags/Packaging | Bags/Packaging |
| Balloon, Latex | Balloon, Latex |
| Balloon, Mylar | Balloon, Mylar |
| Bandage/Bandaid | Bandage/Bandaid |
| Bank Angle | Bank Angle |
| Bank Cover | Bank Cover |
| Bank Stability | Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width) |
| Bankfull Height | Bankfull Height |
| Bankfull Width | Bankfull Width |
| Bankfull Width Reach | Visual estimate of the average bankfull width of the reach |
| Bar Present | Bar Present |
| Bar Width | Bar Width |
| Barban | Barban |
| Barban(Surrogate) | Surrogate: Barban |
| Barium | Barium |
| Barometric Pressure | Barometric Pressure |
| Batteries, Large | Batteries, Large |
| Batteries, Small | Batteries, Small |
| Bearing | Bearing |
| BeaufortScale | BeaufortScale |
| Beaver Flow Modifications | Beaver Flow Modifications |
| Beaver Signs | Beaver Signs |
| Bendiocarb | Bendiocarb |
| Benfluralin | Benfluralin |
| Benomyl | Benomyl |
| Bensulfuron Methyl | Bensulfuron Methyl |
| Bensulide | Bensulide |
| Bentazon | Bentazon |
| Benz(a)anthracene | Benz(a)anthracene |
| Benz(a)anthracene-d12(Surrogate) | Surrogate: Benz(a)anthracene-d12 |
| Benzene | Benzene |
| Benzo [a] Pyrene equivalents | Benzo [a] Pyrene equivalents |
| Benzo(a)fluoranthene | Benzo(a)fluoranthene |
| Benzo(a)pyrene | Benzo(a)pyrene |
| Benzo(a)pyrene-d12(Surrogate) | Benzo(a)pyrene-d12(Surrogate) |
| Benzo(b)fluoranthene | Benzo(b)fluoranthene |
| Benzo(b)fluorene, 11H- | 11H-Benzo(b)fluorene |
| Benzo(e)pyrene | Benzo(e)pyrene |
| Benzo(e)pyrene-d12(Surrogate) | Surrogate: Benzo(e)pyrene-d12 |
| Benzo(g,h,i)perylene | Benzo(g,h,i)perylene |
| Benzo(g,h,i)perylene-d12(Surrogate) | Surrogate: Benzo(g,h,i)perylene-d12 |
| Benzo(j/k)fluoranthene | Benzo(j)fluoranthene/Benzo(k)fluoranthene |
| Benzo(k)fluoranthene | Benzo(k)fluoranthene |
| Benzobicyclon | Benzobicyclon pesticide |
| Beryllium | Beryllium |
| Bezafibrate | Bezafibrate |
| Bicarbonate | Bicarbonate |
| Bifenox | Bifenox |
| Bifenthrin | Bifenthrin |
| Bifenthrin, Total(Surrogate) | Surrogate: Total Bifenthrin |
| Bifenthrin-d5(Surrogate) | Surrogate: Bifenthrin-d5 ((rac-cis)-Z-Bifenthrin-d5) |
| Bifenthrin-d6(Surrogate) | Surrogate: Bifenthrin-d6 |
| Biodegradable | Biodegradeable using Trash Protocol |
| Biodegradable, Other | Biodegradable, Other |
| Biohazard | Biohazard using Trash Protocol |
| Bioluminescence (EC50) | Bioluminescence (EC50) |
| Biomass (wt/orig indiv) | Biomass (weight/original individual) |
| BiomassSampleVolume | Volume of material and liquid filtered to produce the biomass (Ash Free Dry Mass-AFDM) sample |
| Biphenyl | Biphenyl |
| Biphenyl-d10(Surrogate) | Surrogate: Biphenyl-d10 |
| Bis(2,4,6-tribromophenoxy)ethane-1,2 | 1,2-bis(2,4,6-tribromophenoxy)ethane (BTBPE) |
| Bis(2,4,6-tribromophenoxy)ethane-1,2-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2-bis(2,4,6-tribromophenoxy)ethane-13C12 (BTBPE-13C12) |
| Bis(2-chloroethoxy)methane | Bis(2-chloroethoxy)methane |
| Bis(2-chloroethyl)ether | Bis(2-chloroethyl)ether |
| Bis(2-chloroisopropyl) ether | Bis(2-chloroisopropyl) ether |
| Bis(2-ethylhexyl)phthalate | Bis(2-ethylhexyl)phthalate |
| Bis(chloromethyl) Ether | Bis(chloromethyl) Ether (Dichlorodimethyl Ether) |
| Bismuth | Bismuth |
| Bisphenol A | Bisphenol A |
| Bisphenol A-d16(IsoDilAnalogue) | Isotope Dilution Analogue: Bisphenol A-d16 |
| Bisphenol A-d16(Surrogate) | Surrogate: Bisphenol A-d16 |
| Bispyribac Sodium | Bispyribac Sodium |
| Blue-Green Algae Phycocyanin | Blue-Green Algae Phycocyanin (BGA-PC) |
| BOD | Biochemical Oxygen Demand (BOD) - 5 day test |
| BOD10day | Biochemical Oxygen Demand (BOD) - 10 day test |
| Bolstar | Bolstar (Sulprofos) |
| Boron | Boron |
| Boscalid | Boscalid |
| Bottle Cap, Metal | Bottle Cap, Metal |
| Bottle Cap, Plastic | Bottle Cap, Plastic |
| Bottle, Beach | Bottle, Beach |
| Bottle, Cleaning | Bottle, Cleaning |
| Bottle, Glass | Bottle, Glass |
| Bottle, Shampoo | Bottle, Shampoo |
| Bottle, Soda | Bottle, Soda |
| Bottle, Sport | Bottle, Sport |
| Bottle, Water | Bottle, Water |
| Boulder | Boulder |
| BRI | Score for the Benthic Response Index (BRI) |
| Brick | Brick |
| Bridge | Bridge |
| Bridge Fence | Bridge Fence |
| Bridge Fence Height | Bridge Fence Height |
| Bridges, Culverts | Bridges, Culverts |
| Bromacil | Bromacil |
| Bromate | Bromate |
| Bromide | Bromide |
| Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate) | Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC) |
| Bromobenzene | Bromobenzene (Phenyl Bromide) |
| Bromochloromethane | Bromochloromethane |
| Bromodichloromethane | Bromodichloromethane (Dichlorobromomethane) |
| Bromofluorobenzene, 4-(Surrogate) | Surrogate: 4-Bromofluorobenzene |
| Bromoform | Bromoform (Tribromomethane) |
| Bromomethane | Bromomethane (Methyl Bromide) |
| Burial | Burial |
| Burns Extent | Burns Extent |
| Burns Intensity | Burns Intensity |
| Burns Proximity | Burns Proximity |
| Butachlor | Butachlor |
| Butanone, 2- | 2-Butanone (Methyl Ethyl Ketone) |
| Butyl Benzyl Phthalate | Butyl Benzyl Phthalate |
| Butylate | Butylate |
| Butylbenzene, n- | n-Butylbenzene |
| Butylbenzene, sec- | sec-Butylbenzene |
| Butylbenzene, tert- | tert-Butylbenzene |
| Butylhydroxytoluene-d21(Surrogate) | Surrogate: Butylhydroxytoluene-d21 (BHT-d21) |
| CA_LRM | Score for the California Logistic Regression Model (CA LRM) |
| Cadmium | Cadmium |
| Caffeine | Caffeine |
| Caffeine-13C3(Surrogate) | Surrogate: Caffeine-13C3 |
| CAFOs Extent | CAFOs Extent |
| CAFOs Intensity | CAFOs Intensity |
| CAFOs Proximity | CAFOs Proximity |
| Calcium | Calcium |
| Canopy Cover | Canopy Cover |
| Captafol | Captafol |
| Captan | Captan |
| Carbadox | Carbadox |
| Carbamazepine | Carbamazepine |
| Carbaryl | Carbaryl |
| Carbaryl-D7(Surrogate) | Surrogate: Carbaryl-D7 |
| Carbazole | Carbazole |
| Carbazole(Surrogate) | Surrogate: Carbazole |
| Carbofuran | Carbofuran |
| Carbon Dioxide, Daily Mean | Daily Mean Carbon Dioxide (Calculated) |
| Carbon dioxide, free | Carbon dioxide, free |
| Carbon Disulfide | Carbon Disulfide |
| Carbon Tetrachloride | Carbon Tetrachloride |
| Carbon, Total | Total Carbon |
| Carbon-13/Carbon-12 Ratio | Carbon-13/Carbon-12 Ratio |
| Carbon-14 | Carbon-14 |
| Carbon-14 Counting Error | Carbon-14 Counting Error |
| Carbonate | Carbonate |
| Carbophenothion | Carbophenothion (Trithion) |
| Carfentrazone Ethyl | Carfentrazone Ethyl |
| Cascade/Falls | Cascade/Falls |
| Cattle Grazing Intensity | Cattle Grazing Intensity |
| Cattle GrazingExtent | Cattle GrazingExtent |
| Cattle GrazingProximity | Cattle GrazingProximity |
| CD/DVD | CD/DVD |
| Ceramic Pot/Shard | Ceramic Pot/Shard |
| Cerium | Cerium |
| Chamber biomass | Chamber biomass |
| Channel Constraining Feature | Channel Constraining Feature |
| Channel Constraint | Channel Constraint |
| Channel Engineered | Channel has been modified/engineered |
| Channel Grasses | Channel Grasses |
| Channel Margin in Contact | Channel Margin in Contact |
| Channel NonWoody Veg | Channel NonWoody Veg |
| Channel Pattern | Channel Pattern |
| Channel Unit | Channel Unit |
| Channel Width Reach | Channel width used to define reach |
| Channel Woody Veg | Channel Woody Veg |
| Channelization | Channelization |
| Chemical Concentration | Chemical Concentration |
| Chemical Treatment | Chemical Treatment |
| Chlorate | Chlorate |
| Chlordane | Chlordane, not otherwise specified |
| Chlordane, cis- | cis-Chlordane (alpha-Chlordane) |
| Chlordane, Technical | Chlordane, mixture of many related chemicals, of which 10 are major components |
| Chlordane, trans- | trans-Chlordane (gamma-Chlordane) |
| Chlordane-13C10, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane) |
| Chlordene | Chlordene |
| Chlordene, cis- | cis-Chlordene (alpha-Chlordene) |
| Chlordene, trans- | trans-Chlordene (gamma-Chlordene) |
| Chlorfenapyr | Chlorfenapyr |
| Chlorfenvinphos | Chlorfenvinphos |
| Chloride | Chloride |
| Chlorimuron Ethyl | Chlorimuron Ethyl |
| Chlorine, Total Residual | Total Residual Chlorine |
| Chlorite | Chlorite |
| Chloro-2-methylphenoxy) Butanoic Acid, 4-(4- | 4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB) |
| Chloro-3-methylphenol, 4- | 4-Chloro-3-methylphenol |
| Chloroaniline, 4- | 4-Chloroaniline |
| Chlorobenzene | Chlorobenzene |
| Chlorobenzene-d5(Surrogate) | Surrogate: Chlorobenzene-d5 |
| Chlorobenzilate | Chlorobenzilate |
| Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11- | 11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid (11Cl-PF3OUdS) |
| Chloroethane | Chlorethane (Ethyl Chloride) |
| Chloroethyl Vinyl Ether, 2- | 2-Chloroethyl Vinyl Ether |
| Chloroform | Chloroform |
| Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9- | 9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid (9Cl-PF3ONS) |
| Chloromethane | Chloromethane (Methyl Chloride) |
| Chloronaphthalene, 2- | 2-Chloronaphthalene |
| Chloroneb(Surrogate) | Surrogate: Chloroneb |
| Chlorophenol, 2- | 2-Chlorophenol |
| Chlorophenyl Phenyl Ether, 4- | 4-Chlorophenyl Phenyl Ether |
| Chlorophenyl)-N'-methylurea, N-(4- | N-(4-Chlorophenyl)-N'-methylurea |
| Chlorophyll a | Chlorophyll a |
| Chlorophyll, Total | Total Chlorophyll |
| ChlorophyllSampleVolume | Volume of material and liquid filtered to produce the chlorophyll a sample |
| Chloropicrin | Chloropicrin |
| Chloroprene | Chloroprene (Chlorobutadiene) |
| Chlorothalonil | Chlorothalonil |
| Chlorotoluene, 2- | 2-Chlorotoluene |
| Chlorotoluene, 4- | 4-Chlorotoluene |
| Chloroxuron | Chloroxuron (Chloroxyfenidim) (Norex) |
| Chloroxuron(Surrogate) | Surrogate: Chloroxuron (Chloroxyfenidim) (Norex) |
| Chlorpropham | Chlorpropham |
| Chlorpyrifos | Chlorpyrifos |
| Chlorpyrifos Methyl | Chlorpyrifos Methyl |
| Chlorpyrifos Methyl(Surrogate) | Surrogate: Chlorpyrifos Methyl |
| Chlorpyrifos Oxon | Chlorpyrifos Oxon |
| Chlortetracycline | Chlortetracycline |
| Chlorzoxazone | Chlorzoxazone |
| Chromium | Chromium |
| Chromium VI | Chromium VI |
| Chrysene | Chrysene |
| Chrysene/Triphenylene | Chrysene/Triphenylene (CAS #EDF-359) |
| Chrysene-d12(Surrogate) | Surrogate: Chrysene-d12 |
| Chrysenes, C1- | C1-Chrysenes |
| Chrysenes, C2- | C2-Chrysenes |
| Chrysenes, C3- | C3-Chrysenes |
| Cigarette Box/Wrapper | Cigarette Box/Wrapper |
| Cigarette Butt | Cigarette Butt |
| Cinerin-1 | Cinerin-1 |
| Cinerin-2 | Cinerin-2 (Cinerin II) |
| Ciodrin | Ciodrin (Crotoxyphos) |
| Circumference | Circumference |
| Clay | Clay |
| Clomazone | Clomazone (Dimethazone) |
| Clothianidin | Clothianidin |
| Clothianidin-d3(Surrogate) | Surrogate: Clothianidin-d3 |
| Clothing, synthetic fabric | Clothing, synthetic fabric |
| CloudCover | Cloud cover at the time of sampling |
| Cobalt | Cobalt |
| Cobble | Cobble |
| Cocoons | Cocoons (#) |
| COD | Chemical Oxygen Demand (COD) |
| Coliform, Fecal | Fecal Coliform |
| Coliform, Total | Total Coliform |
| CollectionDepth | Depth at which sample was collected |
| CollSub_PlantDead | Algae collected from dead plant (including wood) substratum |
| CollSub_PlantLive | Algae collected from live plant (including wood) substratum |
| CollSub_Rock | Algae collected from rock (including concrete and consolidated sediment) substratum |
| CollSub_SedSoft | Algae collected from soft sediment substratum |
| Color | Color |
| Color, True | Color of water from which turbidity has been removed |
| Commercial | Commercial |
| CompositeVolume | Volume of material and liquid in Composite sample |
| Composition | Composition |
| Computer | Computer |
| Concrete/Asphalt | Concrete/Asphalt |
| Construction | Construction |
| Construction Debris | Construction debris such as brick, wood, sheetrock using Trash Protocol |
| Construction Other | Construction Other |
| Construction Wood/Pellets | Construction Wood/Pellets |
| Container, Chemical | Container, Chemical |
| Container, Juice | Container, Juice |
| Container, Storage | Container, Storage |
| Container, Styrofoam | Container, Styrofoam |
| Copper | Copper |
| Coumaphos | Coumaphos |
| CPOM | Coarse particulate organic matter |
| Cropland | Cropland |
| Crops Irrigated Extent | Crops Irrigated Extent |
| Crops Irrigated Intensity | Crops Irrigated Intensity |
| Crops Irrigated Proximity | Crops Irrigated Proximity |
| Crops NonIrrigated Extent | Crops NonIrrigated Extent |
| Crops NonIrrigated Intensity | Crops NonIrrigated Intensity |
| Crops NonIrrigated Proximity | Crops NonIrrigated Proximity |
| Cryptosporidium | Cryptosporidium |
| CSCI | California Stream Condition Index calculated as the average of the O/E and pMMI |
| CSCI_CaptureProb_Abedus | Probability of capturing Abedus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Acari | Probability of capturing Acari calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Acentrella | Probability of capturing Acentrella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Acneus | Probability of capturing Acneus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Aeshna_Rhionaeshna | Probability of capturing Aeshna or Rhionaeshna calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Agabinus | Probability of capturing Agabinus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Agabus | Probability of capturing Agabus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Agapetus | Probability of capturing Agapetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Allocosmoecus | Probability of capturing Allocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ambrysus | Probability of capturing Ambrysus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ameletus | Probability of capturing Ameletus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ametor | Probability of capturing Ametor calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Amiocentrus | Probability of capturing Amiocentrus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Amphicosmoecus | Probability of capturing Amphicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ampumixis | Probability of capturing Ampumixis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anacaena | Probability of capturing Anacaena calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anagapetus | Probability of capturing Anagapetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anax | Probability of capturing Anax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anchycteis | Probability of capturing Anchycteis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Antocha | Probability of capturing Antocha calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Apatania | Probability of capturing Apatania calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Archilestes | Probability of capturing Archilestes calculated by the California Stream Condition Index (Mazor et al. 2016) |
|