| AnalyteName | AnalyteDescr | CASNumber | pHab_Unit | Water_Unit | Sediment_Unit | Tox_Unit | Fish_Unit | Bivalve_Unit | Group1 | Group2 | Group3 | Group4 | Group5 | Group6 |
| 6-Pack Ring | 6-Pack Ring | | pieces | | | | | | Debris | Trash | Plastics | FoodService | | |
| 6PPD-quinone | 6PPD-quinone (N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine-quinone) | 2754428185 | | ng/L | | | | | Organics | para-Phenylenediamine (PPD) Derivatives | | | | |
| AccesstoWaterbody_BikePath | AccesstoWaterbody_BikePath | | none | | | | | | Habitat | Debris | | | | |
| AccesstoWaterbody_Fence | AccesstoWaterbody_Fence | | none | | | | | | Habitat | Debris | | | | |
| AccesstoWaterbody_HeavyVegetation | AccesstoWaterbody_HeavyVegetation | | none | | | | | | Habitat | Debris | | | | |
| AccesstoWaterbody_ParkingLot | AccesstoWaterbody_ParkingLot | | none | | | | | | Habitat | Debris | | | | |
| AccesstoWaterbody_PicnicArea | AccesstoWaterbody_PicnicArea | | none | | | | | | Habitat | Debris | | | | |
| AccesstoWaterbody_RestrictedAccessMaintenanceRoad | AccesstoWaterbody_RestrictedAccessMaintenanceRoad | | none | | | | | | Habitat | Debris | | | | |
| AccesstoWaterbody_Roadway | AccesstoWaterbody_Roadway | | none | | | | | | Habitat | Debris | | | | |
| AccesstoWaterbody_Walkway | AccesstoWaterbody_Walkway | | none | | | | | | Habitat | Debris | | | | |
| Accumulation | Accumulation using Trash Protocol | | score | | | | | | Trash | | | | | |
| Acenaphthene | Acenaphthene | 83329 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | LMW_PAH | Endocrine Disruptors | |
| Acenaphthene-d10(Surrogate) | Surrogate: Acenaphthene-d10 | 15067262 | | % recovery | % recovery | | % recovery | % recovery | Organics | PAHs | SVOCs | LMW_PAH | Endocrine Disruptors | |
| Acenaphthylene | Acenaphthylene | 208968 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
| Acenaphthylene-d10(Surrogate) | Surrogate: Acenaphthylene-d10 | | | | ng/g dw | | | | | | | | | |
| Acetamiprid | Acetamiprid | 135410207 | | ug/L | ng/g dw | | | | Organics | Pesticides | Insecticides | | | |
| Acetamiprid-d3(Surrogate) | Surrogate: Acetamiprid-d3 | 1353869358 | | % recovery | | | | | Organics | Pesticides | Insecticides | Neonicotinoids | | |
| Acetone | Acetone | 67641 | | ug/L | | | | | Organics | VOCs | | | | |
| Acid Mine Drainage Extent | Acid Mine Drainage Extent | | none | | | | | | Habitat | | | | | |
| Acid Mine Drainage Intensity | Acid Mine Drainage Intensity | | none | | | | | | Habitat | | | | | |
| Acid Mine Drainage Proximity | Acid Mine Drainage Proximity | | none | | | | | | Habitat | | | | | |
| Acid Neutralizing Capacity | Acid Neutralizing Capacity (ANC) | | | ueq/L | | | | | Inorganics | Conventionals | | | | |
| Acid Volatile Sulfides | Acid Volatile Sulfides (AVS) | | | | umol/g dw | | | | Inorganics | Conventionals | | | | |
| Acifluorfen | Acifluorfen | 50594666 | | ug/L | | | | | Organics | Herbicides | | | | |
| Acrolein | Acrolein | 107028 | | ug/L | | | | | | | | | | |
| Acrylonitrile | Acrylonitrile | 107131 | | ug/L | | | | | | | | | | |
| Adsorbable Organic Fluorine | Adsorbable Organic Fluorine (AOF) [detected as Fluoride] | | | ug/L | | | | | Organics | PFAS | | | | |
| Aesthetic Condition | Aesthetic Condition | | none | | | | | | Habitat | Debris | | | | |
| AFDM_Algae | Ash Free Dry Mass primarily of Algae but other items may be weighed | | | mg/L | | | | | Inorganics | Conventionals | | | | |
| Age | Age | | | | | | yr | | Tissue | | | | | |
| Age_Pond | Age (in years) of the pond if it is created | | yr | | | | | | Habitat | | | | | |
| Agricultural Other Extent | Agricultural Other Extent | | none | | | | | | Habitat | | | | | |
| Agricultural Other Intensity | Agricultural Other Intensity | | none | | | | | | Habitat | | | | | |
| Agricultural Other Proximity | Agricultural Other Proximity | | none | | | | | | Habitat | | | | | |
| Agricultural Runoff Extent | Agricultural Runoff Extent | | none | | | | | | Habitat | | | | | |
| Agricultural Runoff Intensity | Agricultural Runoff Intensity | | none | | | | | | Habitat | | | | | |
| Agricultural Runoff Proximity | Agricultural Runoff Proximity | | none | | | | | | Habitat | | | | | |
| Air Traffic Extent | Air Traffic Extent | | none | | | | | | Habitat | | | | | |
| Air Traffic Intensity | Air Traffic Intensity | | none | | | | | | Habitat | | | | | |
| Air Traffic Proximity | Air Traffic Proximity | | none | | | | | | Habitat | | | | | |
| Alachlor | Alachlor (Lasso) | 15972608 | | ug/L | ng/g dw | | | | Organics | Herbicides | Endocrine Disruptors | | | |
| Aldicarb | Aldicarb | 116063 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
| Aldicarb Sulfone | Aldicarb Sulfone | 1646884 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
| Aldicarb Sulfoxide | Aldicarb Sulfoxide | 1646873 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
| Aldrin | Aldrin | 309002 | | ug/L | ug/Kg ww | | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endocrine Disruptors | |
| Aldrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Aldrin-13C12 | | | | | | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
| Algae Cover | Percent of stream's water surface upstream of sample location estimated to be covered with algae | | % | | | | | | FieldObservations | Habitat | | | | |
| Algae Cover Filamentous | Percent of stream's water surface upstream of sample location estimated to be covered with filamentous algae | | % | | | | | | FieldObservations | Habitat | | | | |
| Algae-attached | Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached | | % | | | | | | FieldObservations | Habitat | | | | |
| Algae-floating Mats | Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats | | % | | | | | | FieldObservations | Habitat | | | | |
| Algal Cover Periphyton | Percent of substrate in wetted channel upstream of sample location estimated to be covered with periphyton [living community attached to substrate including algae (not green filamentous type), aquatic mosses, fungi, diatoms & sessile invertebrates] | | % | | | | | | FieldObservations | Habitat | | | | |
| Algal/Surface Mats/Benthic Algal Growth Extent | Algal/Surface Mats/Benthic Algal Growth Extent | | none | | | | | | Habitat | | | | | |
| Algal/Surface Mats/Benthic Algal Growth Intensity | Algal/Surface Mats/Benthic Algal Growth Intensity | | none | | | | | | Habitat | | | | | |
| Algal/Surface Mats/Benthic Algal Growth Proximity | Algal/Surface Mats/Benthic Algal Growth Proximity | | none | | | | | | Habitat | | | | | |
| Alkalinity as CaCO3 | Alkalinity as CaCO3 | 471341 | | mg/L | | | | | Inorganics | Conventionals | WaterQualityMeasurements | Habitat | | |
| Allethrin | Allethrin | 584792 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Alpha Linolenic Acid | Alpha Linolenic Acid | | | | | | mg/100g ww | mg/100g dw | Organics | Omega Fatty Acid | | | | |
| Aluminum | Aluminum | 7429905 | | ug/L | mg/Kg dw | | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
| Aluminum Foil | Aluminum Foil | | pieces | | | | | | Debris | Trash | Non-Plastics | Metal | | |
| Aluminum, Organic Monomeric | Organic Monomeric Aluminum (Organic Reactive) | | | ug/L | | | | | Inorganics | TraceElements | Metals | | | |
| Aluminum, Total Monomeric | Total Monomeric Aluminum (Organic + Inorganic Reactive) | | | ug/L | | | | | Inorganics | TraceElements | Metals | | | |
| Aluminum/Steel Can | Aluminum/Steel Can | | pieces | | | | | | Debris | Trash | Non-Plastics | Metal | | |
| Ametryn | Ametryn | 834128 | | ug/L | | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-Triazines | Herbicides | | |
| Aminocarb | Aminocarb | 2032599 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
| Aminomethyl Phosphonic Acid | Aminomethyl Phosphonic Acid (AMPA) | 1066519 | | ug/L | | | | | Organics | Pesticides | Herbicides | | | |
| Ammonia as N | Ammonia as N | 7664417 | | ug/L | mg/L | | | | Inorganics | Conventionals | Nutrients | | | |
| Ammonia as N, Unionized | Unionized Ammonia as N | 7664417 | | mg/L | | | | | | | | | | |
| Ammonia as NH3 | Ammonia as NH3 | 7664417 | | mg/L | | | | | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | |
| Ammonium as N | Ammonium as N (NH4) | | | mg/L | | | | | Inorganics | Conventionals | Nutrients | | | |
| AMPA(Surrogate) | Surrogate: Aminomethyl Phosphonic Acid (AMPA) | 74341632 | | % recovery | | | | | Organics | Pesticides | | | | |
| Anatoxin-A | Anatoxin-A | 64285069 | | ug/L | | | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
| Anatoxin-a gene, Prokaryotic DNA (anaC) | Anatoxin-a gene Prokaryotic DNA, Target Gene: anaC, Proprietary primer sequences from Bend Genetics LLC | | | gc/mL | | | | | Microbiological | Cyanotoxins | Gene Marker | | | |
| Angling Pressure | Angling Pressure | | none | | | | | | Habitat | | | | | |
| Anilazine | Anilazine | 101053 | | ug/L | | | | | Organics | Pesticides | Fungicides | | | |
| Animal Burrows Extent | Animal Burrows Extent | | none | | | | | | Habitat | | | | | |
| Animal Burrows Intensity | Animal Burrows Intensity | | none | | | | | | Habitat | | | | | |
| Animal Burrows Proximity | Animal Burrows Proximity | | none | | | | | | Habitat | | | | | |
| AnimalPresence | describes presence of animals which may include tracks, scat, sounds or physical presence | | none | | | | | | FieldObservations | Habitat | | | | |
| Anthracene | Anthracene | 120127 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | Endocrine Disruptors | |
| Antimony | Antimony | 7440360 | | ug/L | mg/Kg dw | | | | Inorganics | Metals | Metalloids | | | |
| Appliance | Appliance | | pieces | | | | | | Debris | Trash | Non-Plastics | Large | | |
| AquaticLife | AquaticLife using Trash Protocol | | score | | | | | | Trash | | | | | |
| Arachidonic | Arachidonic | | | | | | mg/100g ww | mg/100g dw | Organics | Omega Fatty Acid | | | | |
| Area | Area | | m2 | | | | | | Tissue | Habitat | | | | |
| Arsenic | Arsenic | 7440382 | | ug/L | mg/Kg dw | | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | Metalloids | | |
| Arsenic, Inorganic | Inorganic Arsenic | 7440382 | | | | | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
| Asbestos, Total | Total Asbestos | | | mf/L | | | | | Inorganics | Conventionals | | | | |
| Ash Free Dry Mass | Ash-Free Dry Mass (AFDM, AFDW) | | | | | | | | Inorganics | Conventionals | Benthic | | | |
| Aspon | Aspon | 3244904 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Atraton | Atraton | 1610179 | | ug/L | | | | | Organics | Pesticides | Pest-Triazines | Herbicides | | |
| Atrazine | Atrazine | 1912249 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-Triazines | Herbicides | Endocrine Disruptors | |
| Atrazine-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Atrazine-13C3 | | | | | | % recovery | % recovery | Organics | Pest-Triazines | IDA | | | |
| Atrazine-13C3(Surrogate) | Surrogate: Atrazine-13C3 | | | % recovery | | | | | Organics | Pesticides | Pest-Triazines | | | |
| Atrazine-d5(Surrogate) | Surrogate: Atrazine-d5 | | | % recovery | | | | | | | | | | |
| Atrazine-Desisopropyl-2-Hydroxy | Atrazine-Desisopropyl-2-Hydroxy | 7313544 | | ug/L | | | | | Organics | Omega Fatty Acid | | | | |
| ATVs Extent | ATVs Extent | | none | | | | | | Habitat | | | | | |
| ATVs Intensity | ATVs Intensity | | none | | | | | | Habitat | | | | | |
| ATVs Proximity | ATVs Proximity | | none | | | | | | Habitat | | | | | |
| Autopart | Autopart | | pieces | | | | | | Debris | Trash | Non-Plastics | Metal | | |
| Azinphos Ethyl | Azinphos Ethyl | 2642719 | | ug/L | mg/Kg dw | | | | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Azinphos Methyl | Azinphos Methyl (Guthion) | 86500 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Azinphos-Methyl-d6(IsoDilAnalogue) | Isotope Dilution Analogue: Azinphos-Methyl-d6 | | | | | | % recovery | % recovery | Organics | Pest-OPs | IDA | | | |
| Azoxystrobin | Azoxystrobin | 131860338 | | ug/L | | | | | Organics | Fungicides | | | | |
| Back Water | Back Water present | | none | | | | | | Habitat | | | | | |
| Bacteroidales, Avian (LeeSeaGull) | Avian Bacteroidales, Assay name: LeeSeaGull, 5’ AGGTGCTAATACCGCATAATACAGAG 3’, 5’ GCCGTTACCTCACCGTCTA 3’ | | | gc/mL | | | | | Microbiological | MST | | | | |
| Bacteroidales, Canine (BacCan) | Canine Bacteroidales, Assay name: BacCan, 5' GGAGCGCAGACGGGTTTT 3', 5' CAATCGGAGTTCTTCGTGATATCTA 3' | | | gc/mL | | | | | Microbiological | MST | | | | |
| Bacteroidales, Cow | Cow Bacteroidales | | | gc/mL | | | | | Microbiological | Pathogens | Conventional | | | |
| Bacteroidales, Cow (BacCow) | Cow Bacteroidales, Assay name: BacCow, 5' CCAACYTTCCCGWTACTC 3', 5' GGACCGTGTCTCAGTTCCAGTG 3' | | | gc/mL | | | | | Microbiological | MST | | | | |
| Bacteroidales, Dog | Dog Bacteroidales | | | gc/mL | | | | | Microbiological | Pathogens | Conventional | | | |
| Bacteroidales, Horse (HoF597F) | Horse Bacteroidales, Assay name: HoF597F, 5' CCAGCCGTAAAATAGTCGG 3', 5' CAATCGGAGTTCTTCGTG 3' | | | gc/mL | | | | | Microbiological | MST | | | | |
| Bacteroidales, Human | Human Bacteroidales | | | gc/mL | | | | | Microbiological | Pathogens | Conventional | | | |
| Bacteroidales, Human (HF183/BacR287) | Human Bacteroidales, Assay name: HF183/BacR287, 5' ATCATGAGTTCACATGTCCG 3, 5'-CTTCCTCTCAGAACCCCTATCC 3' | | | gc/mL | none | | | | Microbiological | MST | | | | |
| Bacteroidales, Human (HF183/BFDrev) | Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3' | | | gc/mL | | | | | Microbiological | MST | | | | |
| Bacteroidales, Ruminant (Rum2Bac) | Ruminant Bacteroidales, Asssay name: Rum2Bac, 5' ACAGCCCGCGATTGATACTGGTAA 3', 5' CAATCGGAGTTCTTCGTGAT 3' | | | gc/mL | none | | | | Microbiological | MST | | | | |
| Bacteroidales, Universal | Universal Bacteroidales | | | gc/mL | | | | | Microbiological | Pathogens | Conventional | | | |
| Bag, Large/Retail | Bag, Large/Retail | | pieces | | | | | | Debris | Trash | Plastics | Bags/Packaging | | |
| Bag, Pet Waste | Bag, Pet Waste | | pieces | | | | | | Debris | Trash | Plastics | Bags/Packaging | | |
| Bag, Single Use Plastic | Bag, Single Use Plastic | | pieces | | | | | | Debris | Trash | Plastics | Bags/Packaging | | |
| Bag, Takeout | Bag, Takeout | | pieces | | | | | | Debris | Trash | Plastics | Bags/Packaging | | |
| Bags/Packaging | Bags/Packaging | | L | | | | | | Debris | Trash | Plastics | | | |
| Balloon, Latex | Balloon, Latex | | pieces | | | | | | Debris | Trash | Plastics | Miscellaneous | | |
| Balloon, Mylar | Balloon, Mylar | | pieces | | | | | | Debris | Trash | Plastics | Miscellaneous | | |
| Bandage/Bandaid | Bandage/Bandaid | | pieces | | | | | | Debris | Trash | Plastics | Miscellaneous | | |
| Bank Angle | Bank Angle | | none | | | | | | Habitat | | | | | |
| Bank Cover | Bank Cover | | none | | | | | | Habitat | | | | | |
| Bank Stability | Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width) | | none | | | | | | Habitat | | | | | |
| Bankfull Height | Bankfull Height | | m | | | | | | Habitat | | | | | |
| Bankfull Width | Bankfull Width | | m | | | | | | Habitat | | | | | |
| Bankfull Width Reach | Visual estimate of the average bankfull width of the reach | | m | | | | | | Habitat | | | | | |
| Bar Present | Bar Present | | none | | | | | | Habitat | | | | | |
| Bar Width | Bar Width | | m | | | | | | Habitat | | | | | |
| Barban | Barban | 101279 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
| Barban(Surrogate) | Surrogate: Barban | 101279 | | % recovery | | | | | Organics | Pesticides | Pest-Carbamates | | | |
| Barium | Barium | 7440393 | | ug/L | mg/Kg dw | | | | Inorganics | Metals | | | | |
| Barometric Pressure | Barometric Pressure | | | | | | | | Habitat | | | | | |
| Batteries, Large | Batteries, Large | | pieces | | | | | | Debris | Trash | Non-Plastics | Toxic | | |
| Batteries, Small | Batteries, Small | | pieces | | | | | | Debris | Trash | Non-Plastics | Toxic | | |
| Bearing | Bearing | | degrees | | | | | | Habitat | | | | | |
| BeaufortScale | BeaufortScale | | none | | | | | | FieldObservations | Habitat | | | | |
| Beaver Flow Modifications | Beaver Flow Modifications | | none | | | | | | Habitat | | | | | |
| Beaver Signs | Beaver Signs | | none | | | | | | Habitat | | | | | |
| Bendiocarb | Bendiocarb | 22781233 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | | | |
| Benfluralin | Benfluralin | 1861401 | | ug/L | | | | | Organics | Pesticides | Herbicides | | | |
| Benomyl | Benomyl | 17804352 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | Endocrine Disruptors | Fungicides | Nematocides |
| Bensulfuron Methyl | Bensulfuron Methyl | 83055996 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | | | |
| Bensulide | Bensulide | | | ug/L | | | | | | | | | | |
| Bentazon | Bentazon | 25057890 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | | | |
| Benz(a)anthracene | Benz(a)anthracene | 56553 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Benz(a)anthracene-d12(Surrogate) | Surrogate: Benz(a)anthracene-d12 | 1718532 | | % recovery | % recovery | | % recovery | % recovery | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Benzene | Benzene | 71432 | | ug/L | | | | | Organics | VOCs | MTBE_BTEX | | | |
| Benzidine | Benzidine | 92875 | | ug/L | | | | | Organics | SVOCs | | | | |
| Benzo(a)fluoranthene | Benzo(a)fluoranthene | 203338 | | | ng/g dw | | | | Organics | PAHs | SVOCs | | | |
| Benzo(a)pyrene | Benzo(a)pyrene | 50328 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Benzo(a)pyrene-d12(Surrogate) | Benzo(a)pyrene-d12(Surrogate) | 63466717 | | % recovery | | | | | Organics | PAHs | | | | |
| Benzo(b)fluoranthene | Benzo(b)fluoranthene | 205992 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Benzo(b)fluorene, 11H- | 11H-Benzo(b)fluorene | 243174 | | | ng/g dw | | | | | | | | | |
| Benzo(e)pyrene | Benzo(e)pyrene | 192972 | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Benzo(e)pyrene-d12(Surrogate) | Surrogate: Benzo(e)pyrene-d12 | 205440820 | | % recovery | % recovery | | | | Organics | PAHs | SVOCs | | | |
| Benzo(g,h,i)perylene | Benzo(g,h,i)perylene | 191242 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Benzo(g,h,i)perylene-d12(Surrogate) | Surrogate: Benzo(g,h,i)perylene-d12 | 93951667 | | % recovery | % recovery | | % recovery | % recovery | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Benzo(j/k)fluoranthene | Benzo(j)fluoranthene/Benzo(k)fluoranthene | | | | ng/g dw | | | | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Benzo(k)fluoranthene | Benzo(k)fluoranthene | 207089 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Benzobicyclon | Benzobicyclon pesticide | | | ug/L | | | | | | | | | | |
| Beryllium | Beryllium | 7440417 | | ug/L | mg/Kg dw | | | | Inorganics | Metals | | | | |
| Bicarbonate | Bicarbonate | 71523 | | mg/L | | | | | Inorganics | Conventionals | | | | |
| Bifenox | Bifenox | 42576023 | | ug/L | | | | | Organics | Pesticides | Herbicides | | | |
| Bifenthrin | Bifenthrin | 82657043 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Bifenthrin, Total(Surrogate) | Surrogate: Total Bifenthrin | | | % recovery | | | | | Organics | Pesticides | | | | |
| Bifenthrin-d5(Surrogate) | Surrogate: Bifenthrin-d5 ((rac-cis)-Z-Bifenthrin-d5) | 2714484156 | | % recovery | % recovery | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Bifenthrin-d6(Surrogate) | Surrogate: Bifenthrin-d6 | | | % recovery | % recovery | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Biodegradable, Other | Biodegradable, Other | | pieces | | | | | | Debris | Natural | Non-Plastics | Biodegradable | | |
| Biomass (wt/orig indiv) | Biomass (weight/original individual) | | | | | mg/ind | | | Toxicity | | | | | |
| Biphenyl | Biphenyl | 92524 | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | LMW_PAH | | |
| Biphenyl-d10(Surrogate) | Surrogate: Biphenyl-d10 | 1486017 | | % recovery | % recovery | | % recovery | % recovery | Organics | PAHs | SVOCs | | | |
| Bis(2,4,6-tribromophenoxy)ethane-1,2 | 1,2-bis(2,4,6-tribromophenoxy)ethane (BTBPE) | 37853591 | | | | | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
| Bis(2,4,6-tribromophenoxy)ethane-1,2-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2-bis(2,4,6-tribromophenoxy)ethane-13C12 (BTBPE-13C12) | | | | | | % recovery | % recovery | Organics | FlameRetardants | IDA | | | |
| Bis(2-chloroethyl)ether | Bis(2-chloroethyl)ether | 111444 | | ug/L | | | | | Organics | SVOCs | | | | |
| Bisphenol A | Bisphenol A | 80057 | | ng/L | | | | | Organics | PPCPs | Pharmaceuticals | | | |
| Bisphenol A-d16(IsoDilAnalogue) | Isotope Dilution Analogue: Bisphenol A-d16 | 96210876 | | % recovery | | | | | Organics | PPCPs | IDA | | | |
| Bisphenol A-d16(Surrogate) | Surrogate: Bisphenol A-d16 | 96210876 | | % recovery | | | | | Organics | PPCPs | Bisphenols | | | |
| Bispyribac Sodium | Bispyribac Sodium | 125401925 | | ug/L | | | | | Organics | Pesticides | Herbicides | | | |
| Blue-Green Algae Phycocyanin | Blue-Green Algae Phycocyanin (BGA-PC) | | | ug/L | | | | | WaterQualityMeasurements | Organics | | | | |
| BOD | Biochemical Oxygen Demand (BOD) - 5 day test | | | mg/L | | | | | Inorganics | Conventionals | | | | |
| Bolstar | Bolstar (Sulprofos) | 35400432 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Boron | Boron | 7440428 | | ug/L | | | | | Inorganics | Conventionals | Metals | Metalloids | | |
| Boscalid | Boscalid | 188425856 | | ug/L | | | | | Organics | Fungicides | | | | |
| Bottle Cap, Metal | Bottle Cap, Metal | | pieces | | | | | | Debris | Trash | Non-Plastics | Metal | | |
| Bottle Cap, Plastic | Bottle Cap, Plastic | | pieces | | | | | | Debris | Trash | Plastics | FoodService | | |
| Bottle, Beach | Bottle, Beach | | pieces | | | | | | Debris | Trash | Plastics | Toxic | | |
| Bottle, Cleaning | Bottle, Cleaning | | pieces | | | | | | Debris | Trash | Plastics | Toxic | | |
| Bottle, Glass | Bottle, Glass | | pieces | | | | | | Debris | Trash | Non-Plastics | Household | | |
| Bottle, Shampoo | Bottle, Shampoo | | pieces | | | | | | Debris | Trash | Plastics | Household | | |
| Bottle, Soda | Bottle, Soda | | pieces | | | | | | Debris | Trash | Plastics | FoodService | | |
| Bottle, Sport | Bottle, Sport | | pieces | | | | | | Debris | Trash | Plastics | FoodService | | |
| Bottle, Water | Bottle, Water | | pieces | | | | | | Debris | Trash | Plastics | FoodService | | |
| Brick | Brick | | pieces | | | | | | Debris | Trash | Non-Plastics | Construction | | |
| Bridge | Bridge | | none | | | | | | Habitat | Debris | | | | |
| Bridge Fence | Bridge Fence | | none | | | | | | Habitat | Debris | | | | |
| Bridge Fence Height | Bridge Fence Height | | m | | | | | | Habitat | Debris | | | | |
| Bridges, Culverts | Bridges, Culverts | | none | | | | | | Habitat | | | | | |
| Bromacil | Bromacil | 314409 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
| Bromide | Bromide | 24959679 | | ug/L | | | | | Inorganics | Conventionals | Nutrients | | | |
| Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate) | Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC) | 672991 | | % recovery | | | | | Organics | Pesticides | Pest-OCHs | | | |
| Bromobenzene | Bromobenzene (Phenyl Bromide) | 108861 | | ug/L | | | | | Organics | VOCs | | | | |
| Bromochloromethane | Bromochloromethane | 74975 | | ug/L | | | | | Organics | VOCs | | | | |
| Bromodichloromethane | Bromodichloromethane (Dichlorobromomethane) | 75274 | | ug/L | | | | | Organics | VOCs | | | | |
| Bromofluorobenzene, 4-(Surrogate) | Surrogate: 4-Bromofluorobenzene | 460004 | | % recovery | | | | | Organics | VOCs | | | | |
| Bromoform | Bromoform (Tribromomethane) | 75252 | | ug/L | | | | | Organics | VOCs | | | | |
| Bromomethane | Bromomethane (Methyl Bromide) | 74839 | | ug/L | | | | | Organics | VOCs | | | | |
| Burns Extent | Burns Extent | | none | | | | | | Habitat | | | | | |
| Burns Intensity | Burns Intensity | | none | | | | | | Habitat | | | | | |
| Burns Proximity | Burns Proximity | | none | | | | | | Habitat | | | | | |
| Butachlor | Butachlor | 23184669 | | ug/L | | | | | Organics | Herbicides | | | | |
| Butanone, 2- | 2-Butanone (Methyl Ethyl Ketone) | 78933 | | ug/L | | | | | Organics | VOCs | | | | |
| Butylate | Butylate | 2008415 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pest-Carbamates | | | |
| Butylbenzene, n- | n-Butylbenzene | 104518 | | ug/L | | | | | Organics | VOCs | | | | |
| Butylbenzene, sec- | sec-Butylbenzene | 135988 | | ug/L | | | | | Organics | VOCs | | | | |
| Butylbenzene, tert- | tert-Butylbenzene | 98066 | | ug/L | | | | | Organics | VOCs | | | | |
| CA_LRM | Score for the California Logistic Regression Model (CA LRM) | | | | score | | | | Sediment Quality Objectives | Index/Metric | | | | |
| Cadmium | Cadmium | 7440439 | | ug/L | mg/Kg dw | | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
| Caffeine | Caffeine | 95789132 | | ug/L | | | | | Organics | PPCPs | | | | |
| Caffeine-13C(Surrogate) | Surrogate: Caffeine-13C | 202282982 | | % recovery | | | | | Organics | PPCPs | | | | |
| Caffeine-13C3(Surrogate) | Surrogate: Caffeine-13C3 | | | % recovery | | | | | | | | | | |
| CAFOs Extent | CAFOs Extent | | none | | | | | | Habitat | | | | | |
| CAFOs Intensity | CAFOs Intensity | | none | | | | | | Habitat | | | | | |
| CAFOs Proximity | CAFOs Proximity | | none | | | | | | Habitat | | | | | |
| Calcium | Calcium | 7440702 | | ug/L | | | | | Inorganics | Conventionals | Metals | | | |
| Canopy Cover | Canopy Cover | | none | | | | | | Habitat | | | | | |
| Captafol | Captafol | 2425061 | | ug/L | | | | | Organics | Pesticides | Fungicides | | | |
| Captan | Captan | 133062 | | ug/L | | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
| Carbadox | Carbadox | 6804075 | | ug/L | | | | | Organics | PPCPs | | | | |
| Carbamazepine | Carbamazepine | 298464 | | ug/L | | | | | Organics | PPCPs | | | | |
| Carbaryl | Carbaryl | 63252 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pest-Carbamates | Insecticides | Endocrine Disruptors | |
| Carbaryl-D7(Surrogate) | Surrogate: Carbaryl-D7 | 362049567 | | % recovery | % recovery | | | | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
| Carbazole | Carbazole | 86748 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | SVOCs | | | | |
| Carbazole(Surrogate) | Surrogate: Carbazole | 86748 | | % recovery | | | | | Organics | Semi-VOAs | | | | |
| Carbofuran | Carbofuran | 1563662 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pest-Carbamates | Insecticides | Nematocides | |
| Carbon Dioxide, Daily Mean | Daily Mean Carbon Dioxide (Calculated) | 124389 | | uatm | | | | | WaterQualityMeasurements | Conventionals | | | | |
| Carbon Disulfide | Carbon Disulfide | | | ug/L | | | | | | | | | | |
| Carbon Tetrachloride | Carbon Tetrachloride | 56235 | | ug/L | | | | | Organics | VOCs | | | | |
| Carbon-13/Carbon-12 Ratio | Carbon-13/Carbon-12 Ratio | 14762744 | | per mil | | | | | Radiochemistry | | | | | |
| Carbon-14 | Carbon-14 | 14762755 | | % modern | | | | | Radiochemistry | | | | | |
| Carbon-14 Counting Error | Carbon-14 Counting Error | | | % modern | | | | | Radiochemisty | | | | | |
| Carbonate | Carbonate | 3812326 | | mg/L | | | | | Inorganics | Conventionals | | | | |
| Carbophenothion | Carbophenothion (Trithion) | 786196 | | ug/L | mg/Kg dw | | | | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Carfentrazone Ethyl | Carfentrazone Ethyl | 128639021 | | ug/L | | | | | Organics | Pesticides | Herbicides | | | |
| Cascade/Falls | Cascade/Falls | | % | | | | | | Habitat | | | | | |
| Cattle Grazing Intensity | Cattle Grazing Intensity | | none | | | | | | Habitat | | | | | |
| Cattle GrazingExtent | Cattle GrazingExtent | | none | | | | | | Habitat | | | | | |
| Cattle GrazingProximity | Cattle GrazingProximity | | none | | | | | | Habitat | | | | | |
| CD/DVD | CD/DVD | | pieces | | | | | | Debris | Trash | Plastics | Household | | |
| Ceramic Pot/Shard | Ceramic Pot/Shard | | pieces | | | | | | Debris | Trash | Non-Plastics | Household | | |
| Channel Constraining Feature | Channel Constraining Feature | | none | | | | | | Habitat | | | | | |
| Channel Constraint | Channel Constraint | | none | | | | | | Habitat | | | | | |
| Channel Engineered | Channel has been modified/engineered | | none | | | | | | Habitat | FieldObservations | | | | |
| Channel Grasses | Channel Grasses | | % | | | | | | Habitat | | | | | |
| Channel Margin in Contact | Channel Margin in Contact | | % | | | | | | Habitat | | | | | |
| Channel NonWoody Veg | Channel NonWoody Veg | | % | | | | | | Habitat | | | | | |
| Channel Pattern | Channel Pattern | | none | | | | | | Habitat | | | | | |
| Channel Unit | Channel Unit | | none | | | | | | Habitat | | | | | |
| Channel Width Reach | Channel width used to define reach | | m | | | | | | Habitat | | | | | |
| Channel Woody Veg | Channel Woody Veg | | % | | | | | | Habitat | | | | | |
| Channelization | Channelization | | none | | | | | | Habitat | | | | | |
| Chemical Treatment | Chemical Treatment | | none | | | | | | Habitat | | | | | |
| Chlordane | Chlordane, not otherwise specified | 57749 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | | | |
| Chlordane, cis- | cis-Chlordane (alpha-Chlordane) | 5103719 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Chlordanes | |
| Chlordane, Technical | Chlordane, mixture of many related chemicals, of which 10 are major components | 12789036 | | | ug/Kg dw | | | | Organics | Pesticides | Pest-OCHs | | | |
| Chlordane, trans- | trans-Chlordane (gamma-Chlordane) | 5103742 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Chlordanes | |
| Chlordane-13C10, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane) | | | | % recovery | | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
| Chlordene | Chlordene | 3734483 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | |
| Chlordene, cis- | cis-Chlordene (alpha-Chlordene) | 56534022 | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | |
| Chlordene, trans- | trans-Chlordene (gamma-Chlordene) | 56641384 | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | |
| Chlorfenapyr | Chlorfenapyr | 122453730 | | ug/L | | | | | Organics | Pesticides | | | | |
| Chlorfenvinphos | Chlorfenvinphos | 470906 | | ug/L | mg/Kg dw | | | | Organics | Pesticides | Pest-OPs | | | |
| Chloride | Chloride | 16887006 | | mg/L | | | | | Inorganics | Conventionals | Nutrients | | | |
| Chlorimuron Ethyl | Chlorimuron Ethyl | 90982324 | | ug/L | | | | | Organics | SVOCs | | | | |
| Chloro-2-methylphenoxy) Butanoic Acid, 4-(4- | 4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB) | 94815 | | ug/L | | | | | Organics | SVOCs | | | | |
| Chlorobenzene | Chlorobenzene | 108907 | | ug/L | | | | | Organics | VOCs | | | | |
| Chlorobenzene-d5(Surrogate) | Surrogate: Chlorobenzene-d5 | 3114554 | | % recovery | | | | | Organics | VOCs | | | | |
| Chlorobenzilate | Chlorobenzilate | 510156 | | ug/L | | | | | Organics | Pesticides | | | | |
| Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11- | 11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid (11Cl-PF3OUdS) | 763051929 | | | ng/g dw | | ug/Kg ww | ug/Kg dw | Organics | PFAS | | | | |
| Chloroethane | Chlorethane (Ethyl Chloride) | 75003 | | ug/L | | | | | Organics | VOCs | | | | |
| Chloroethyl Vinyl Ether, 2- | 2-Chloroethyl Vinyl Ether | 110758 | | ug/L | | | | | Organics | VOCs | | | | |
| Chloroform | Chloroform | 67663 | | ug/L | | | | | Organics | VOCs | Insecticides | | | |
| Chlorohexadecafluoro-3-oxanonane-1-sulfonate, 9- | 9-chlorohexadecafluoro-3-oxanonane-1-sulfonate (9Cl-PF3ONS) | 1621485219 | | | ng/g dw | | ug/Kg ww | ug/Kg dw | Organics | PFAS | | | | |
| Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9- | 9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid (9Cl-PF3ONS) | 756426581 | | | | | ug/Kg ww | ug/Kg dw | Organics | PFAS | | | | |
| Chloromethane | Chloromethane (Methyl Chloride) | 74873 | | ug/L | | | | | Organics | VOCs | | | | |
| Chloronaphthalene, 2- | 2-Chloronaphthalene | 91587 | | ug/L | ug/Kg dw | | | | Organics | SVOCs | | | | |
| Chloroneb(Surrogate) | Surrogate: Chloroneb | 2675776 | | % recovery | | | | | Organics | Pesticides | Pest-OCHs | Fungicides | | |
| Chlorophenyl)-N'-methylurea, N-(4- | N-(4-Chlorophenyl)-N'-methylurea | 5352885 | | ug/L | | | | | Organics | Herbicides | | | | |
| Chlorophyll a | Chlorophyll a | 479618 | | ug/L | | | | | Inorganics | Conventionals | Benthic | WaterQualityMeasurements | | |
| Chlorophyll, Total | Total Chlorophyll | | | ug/L | | | | | WaterQualityMeasurements | | | | | |
| ChlorophyllSampleVolume | Volume of material and liquid filtered to produce the chlorophyll a sample | | | mL | | | | | Habitat | | | | | |
| Chloropicrin | Chloropicrin | | | ug/L | | | | | | | | | | |
| Chlorothalonil | Chlorothalonil | 1897456 | | ug/L | | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | Algaecides | Fungicides | Nematocides |
| Chlorotoluene, 2- | 2-Chlorotoluene | 95498 | | ug/L | | | | | Organics | VOCs | | | | |
| Chlorotoluene, 4- | 4-Chlorotoluene | 106434 | | ug/L | | | | | Organics | VOCs | | | | |
| Chloroxuron | Chloroxuron (Chloroxyfenidim) (Norex) | 1982474 | | ug/L | | | | | Organics | Herbicides | | | | |
| Chloroxuron(Surrogate) | Surrogate: Chloroxuron (Chloroxyfenidim) (Norex) | | | % recovery | | | | | | | | | | |
| Chlorpropham | Chlorpropham | 101213 | | ug/L | | | | | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
| Chlorpyrifos | Chlorpyrifos | 2921882 | | ug/L | ug/Kg dw | | ug/g ww | ug/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Chlorpyrifos Methyl | Chlorpyrifos Methyl | 5598130 | | ug/L | ng/g dw | | ug/g ww | ug/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Chlorpyrifos Methyl(Surrogate) | Surrogate: Chlorpyrifos Methyl | 5598130 | | % recovery | | | | | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Chlorpyrifos Oxon | Chlorpyrifos Oxon | 5598152 | | | | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Chlortetracycline | Chlortetracycline | 57625 | | ug/L | | | | | Organics | PPCPs | | | | |
| Chlorzoxazone | Chlorzoxazone | 95250 | | | ug/Kg dw | | | | | | | | | |
| Chromium | Chromium | 7440473 | | ug/L | mg/Kg dw | | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
| Chromium VI | Chromium VI | | | ug/L | ug/Kg dw | | | | | | | | | |
| Chrysene | Chrysene | 218019 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Chrysene/Triphenylene | Chrysene/Triphenylene (CAS #EDF-359) | | | | ng/g dw | | | | Organics | PAHs | | | | |
| Chrysene-d12(Surrogate) | Surrogate: Chrysene-d12 | 1719035 | | ug/L | % recovery | | | | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Chrysenes, C1- | C1-Chrysenes | | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Chrysenes, C2- | C2-Chrysenes | | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Chrysenes, C3- | C3-Chrysenes | | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
| Cigarette Box/Wrapper | Cigarette Box/Wrapper | | pieces | | | | | | Debris | Trash | Plastics | Miscellaneous | | |
| Cigarette Butt | Cigarette Butt | | pieces | | | | | | Debris | Trash | Plastics | Toxic | | |
| Cinerin-1 | Cinerin-1 | 25402066 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pyrethrins | Insecticides | | |
| Cinerin-2 | Cinerin-2 (Cinerin II) | 121200 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pyrethrins | Insecticides | | |
| Ciodrin | Ciodrin (Crotoxyphos) | 7700176 | | ug/L | mg/Kg dw | | | | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Circumference | Circumference | | m | | | | | | Habitat | | | | | |
| Clay | Clay | | | | % | | | | Inorganics | Conventionals | GrainSize | | | |
| Clomazone | Clomazone (Dimethazone) | 81777891 | | ug/L | | | | | Organics | Pesticides | Herbicides | | | |
| Clothianidin | Clothianidin | | | ug/L | | | | | Organics | Pesticides | Neonicotinoids | | | |
| Clothianidin-d3(Surrogate) | Surrogate: Clothianidin-d3 | | | % recovery | | | | | Organics | Pesticides | | | | |
| Clothing, synthetic fabric | Clothing, synthetic fabric | | pieces | | | | | | Debris | Trash | Plastics | Household | | |
| CloudCover | Cloud cover at the time of sampling | | % | | | | | | Habitat | | | | | |
| Cobalt | Cobalt | 7697372 | | ug/L | mg/Kg dw | | | | Inorganics | Metals | | | | |
| COD | Chemical Oxygen Demand (COD) | | | mg/L | | | | | Inorganics | Conventionals | | | | |
| Coliform, Fecal | Fecal Coliform | | | MPN/100 mL | | | MPN/100 mL | MPN/100 mL | Microbiological | Pathogens | Conventional | | | |
| Coliform, Total | Total Coliform | | | MPN/100 mL | | | MPN/100 mL | MPN/100 mL | Microbiological | Pathogens | Conventional | | | |
| CollSub_PlantDead | Algae collected from dead plant (including wood) substratum | | none | | | | | | Habitat | | | | | |
| CollSub_PlantLive | Algae collected from live plant (including wood) substratum | | none | | | | | | Habitat | | | | | |
| CollSub_Rock | Algae collected from rock (including concrete and consolidated sediment) substratum | | none | | | | | | Habitat | | | | | |
| CollSub_SedSoft | Algae collected from soft sediment substratum | | none | | | | | | Habitat | | | | | |
| Color | Color | | | none | none | | | | FieldObservations | Habitat | | | | |
| Color, True | Color of water from which turbidity has been removed | | | CU | | | | | Inorganics | Conventionals | | | | |
| Commercial | Commercial | | none | | | | | | Habitat | | | | | |
| Composition | Composition | | | | none | | | | FieldObservations | Habitat | | | | |
| Computer | Computer | | pieces | | | | | | Debris | Trash | Plastics | Non-Plastics | Toxic | Large |
| Concrete/Asphalt | Concrete/Asphalt | | pieces | | | | | | Debris | Trash | Non-Plastics | Construction | | |
| Construction | Construction | | none | | | | | | Habitat | | | | | |
| Construction Other | Construction Other | | pieces | | | | | | Debris | Trash | Non-Plastics | Construction | | |
| Construction Wood/Pellets | Construction Wood/Pellets | | pieces | | | | | | Debris | Trash | Non-Plastics | Large | | |
| Container, Chemical | Container, Chemical | | pieces | | | | | | Debris | Trash | Plastics | Toxic | | |
| Container, Juice | Container, Juice | | pieces | | | | | | Debris | Trash | Plastics | FoodService | | |
| Container, Storage | Container, Storage | | pieces | | | | | | Debris | Trash | Plastics | Household | | |
| Container, Styrofoam | Container, Styrofoam | | pieces | | | | | | Debris | Trash | Plastics | FoodService | | |
| Copper | Copper | 7440508 | | ug/L | mg/Kg dw | | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
| Coumaphos | Coumaphos | 56724 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
| C-Phycocyanin | C-Phycocyanin | 11016152 | | ug/L | | | | | Inorganics | Conventionals | | | | |
| CPOM | Coarse particulate organic matter | | none | | | | | | Habitat | | | | | |
| Cropland | Cropland | | none | | | | | | Habitat | | | | | |
| Crops Irrigated Extent | Crops Irrigated Extent | | none | | | | | | Habitat | | | | | |
| Crops Irrigated Intensity | Crops Irrigated Intensity | | none | | | | | | Habitat | | | | | |
| Crops Irrigated Proximity | Crops Irrigated Proximity | | none | | | | | | Habitat | | | | | |
| Crops NonIrrigated Extent | Crops NonIrrigated Extent | | none | | | | | | Habitat | | | | | |
| Crops NonIrrigated Intensity | Crops NonIrrigated Intensity | | none | | | | | | Habitat | | | | | |
| Crops NonIrrigated Proximity | Crops NonIrrigated Proximity | | none | | | | | | Habitat | | | | | |
| Cryptosporidium | Cryptosporidium | | | cysts/L | | | | | Microbiological | Pathogens | Conventional | | | |
| Cup | Cup | | pieces | | | | | | Debris | Trash | Plastics | FoodService | | |
| Cup, Styrofoam | Cup, Styrofoam | | pieces | | | | | | Debris | Trash | Plastics | Bags/Packaging | | |
| Cup, Waxed Paper | Cup, Waxed Paper | | pieces | | | | | | Debris | Trash | Plastics | Non-Plastics | FoodService | |
| Cyanazine | Cyanazine | 21725452 | | ug/L | | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-Triazines | Herbicides | | |
| Cyanide | Cyanide | 57125 | | mg/L | | | | | Inorganics | Conventionals | | | | |
| Cyanobacteria, Prokaryotic DNA (16S) | Total Cyanobacteria, Prokaryotic DNA, Target gene: 16S, Proprietary primer sequences from Bend Genetics LLC | | | gc/mL | | | | | Microbiological | Cyanotoxins | Gene Marker | | | |
| CyanotoxinSampleVolume | Volume of material and liquid in Cyanotoxin sample | | | mL | | | | | Habitat | | | | | |
| Cycloate | Cycloate | 1134232 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pest-Carbamates | | | |
| Cyfluthrin, Total | Total Cyfluthrin | 68539375 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cyfluthrin-1 | Cyfluthrin peak 1 | 68359375 | | ug/L | | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cyfluthrin-2 | Cyfluthrin peak 2 | 68359375 | | ug/L | | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cyfluthrin-3 | Cyfluthrin peak 3 | 68359375 | | ug/L | | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cyfluthrin-4 | Cyfluthrin peak 4 | 68359375 | | ug/L | | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cyhalofop-butyl | Cyhalofop-butyl | 122008859 | | ug/L | | | | | Organics | Pesticides | Herbicides | | | |
| Cyhalothrin, lambda-1 | lambda-Cyhalothrin, peak 1 or Warrior-1 | 91465086 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cyhalothrin, lambda-2 | lambda-Cyhalothrin, peak 2 or Warrior-2 | 91465086 | | ug/L | | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cyhalothrin, Total lambda- | Total lambda-Cyhalothrin, sum peaks 1 & 2 | 91465086 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cyhalothrin-d6, Total lambda-(Surrogate) | Surrogate: Total lambda-Cyhalothrin-d6 | | | % recovery | | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cylindrospermopsin | Cylindrospermopsin | | | ug/L | | | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
| Cylindrospermopsin gene, Prokaryotic DNA (cyrA) | Cylindrospermopsin gene, Prokaryotic DNA, Target Gene: cyrA, Proprietary primer sequences from Bend Genetics LLC | | | gc/mL | | | | | Microbiological | Cyanotoxins | Gene Marker | | | |
| Cypermethrin, Total | Total Cypermethrin, sum peaks 1,2,3 & 4 | 52315078 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cypermethrin-1 | Cypermethrin peak 1 | 67375308 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cypermethrin-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Cypermethrin-13C6 | 0 | | | % recovery | | | | Organics | Pesticides | Pyrethroids | Insecticides | IDA | |
| Cypermethrin-2 | Cypermethrin peak 2 | 65731842 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cypermethrin-3 | Cypermethrin peak 3 | 67375308 | | ug/L | | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cypermethrin-4 | Cypermethrin peak 4 | 52315078 | | ug/L | | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Cyprodinil | Cyprodinil | 121552612 | | ug/L | | | | | | | | | | |
| Dacthal | Dacthal | 1861321 | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | | | |
| Dairies Extent | Dairies Extent | | none | | | | | | Habitat | | | | | |
| Dairies Intensity | Dairies Intensity | | none | | | | | | Habitat | | | | | |
| Dairies Proximity | Dairies Proximity | | none | | | | | | Habitat | | | | | |
| Dam Extent | Dam Extent | | none | | | | | | Habitat | | | | | |
| Dam Intensity | Dam Intensity | | none | | | | | | Habitat | | | | | |
| Dam Proximity | Dam Proximity | | none | | | | | | Habitat | | | | | |
| Dams | Dams | | none | | | | | | Habitat | | | | | |
| DBCE(Surrogate) | Surrogate: Dibutylchlorendate | 1770805 | | % recovery | % recovery | | % recovery | % recovery | Organics | Pesticides | Pest-OCHs | | | |
| DCBP(p,p') | p,p'-Dichlorobenzophenone (DCBP) | 90982 | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | | | |
| DDD(o,p') | o,p'-DDD | 53190 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
| DDD(p,p') | p,p'-DDD | 72548 | | ug/L | ug/Kg ww | | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
| DDD(p,p')(Surrogate) | Surrogate: p,p'-DDD | 72548 | | % recovery | % recovery | | % recovery | % recovery | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
| DDD-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDD-13C12 | | | | | | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
| DDD-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDD-13C12 | | | | % recovery | | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
| DDE(o,p') | o,p'-DDE | 3424826 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
| DDE(p,p') | p,p'-DDE | 72559 | | ug/L | ug/Kg ww | | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
| DDE-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDE-13C12 | | | | % recovery | | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
| DDE-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDE-13C12 | 201612502 | | | % recovery | | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
| DDMU(p,p') | p,p'-DDMU | 1022226 | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
| DDT(o,p') | o,p'-DDT | 789026 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
| DDT(p,p') | p,p'-DDT | 50293 | | ug/L | ug/Kg ww | | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
| DDT-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDT-13C12 | | | | % recovery | | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
| DDT-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDT-13C12 | 104215841 | | | % recovery | | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
| Dead Domestic Animals | Dead Domestic Animals | | pieces | | | | | | Debris | Trash | Non-Plastics | Marine Origin | | |
| Debris Lines/Silt-Laden Vegetation Extent | Debris Lines/Silt-Laden Vegetation Extent | | none | | | | | | Habitat | | | | | |
| Debris Lines/Silt-Laden Vegetation Intensity | Debris Lines/Silt-Laden Vegetation Intensity | | none | | | | | | Habitat | | | | | |
| Debris Lines/Silt-Laden Vegetation Proximity | Debris Lines/Silt-Laden Vegetation Proximity | | none | | | | | | Habitat | | | | | |
| DebrisLandUse_Commercial | DebrisLandUse_Commercial | | none | | | | | | Habitat | Debris | | | | |
| DebrisLandUse_Industrial | DebrisLandUse_Industrial | | none | | | | | | Habitat | Debris | | | | |
| DebrisLandUse_LimitedTimeParking | DebrisLandUse_LimitedTimeParking | | none | | | | | | Habitat | Debris | | | | |
| DebrisLandUse_OpenSpace | DebrisLandUse_OpenSpace | | none | | | | | | Habitat | Debris | | | | |
| DebrisLandUse_Park | DebrisLandUse_Park | | none | | | | | | Habitat | Debris | | | | |
| DebrisLandUse_ParkingLot | DebrisLandUse_ParkingLot | | none | | | | | | Habitat | Debris | | | | |
| DebrisLandUse_Residential | DebrisLandUse_Residential | | none | | | | | | Habitat | Debris | | | | |
| Decabromodiphenylethane | Decabromodiphenylethane (DBDPE) | 84852539 | | | | | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
| Decabromodiphenylethane-13C14(IsoDilAnalogue) | Isotope Dilution Analogue: Decabromodiphenylethane-13C14 (DBDPE-13C14) | | | | | | % recovery | % recovery | Organics | FlameRetardants | IDA | | | |
| Decachlorobiphenyl(Surrogate) | Surrogate: Decachlorobiphenyl | 2051243 | | % recovery | mg/Kg dw | | % recovery | % recovery | Organics | PCBs | | | | |
| Decafluorobiphenyl(Surrogate) | Surrogate: Decafluorobiphenyl | 434902 | | % recovery | | | | | Organics | PAHs | SVOCs | | | |
| Decamethylcyclopentasiloxane | Decamethylcyclopentasiloxane | 541026 | | | ug/Kg dw | | | | | | | | | |
| Deisopropyl-Atrazine | Deisopropyl-Atrazine | 1007289 | | ug/L | | | | | Organics | Pesticides | Herbicides | Triazines | | |
| Deltamethrin | Deltamethrin | 52918635 | | ug/L | ng/g dw | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Deltamethrin/Tralomethrin | Deltamethrin/Tralomethrin | | | ug/L | ng/g ww | | ng/g ww | ng/g dw | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Deltamethrin-d6, Total(Surrogate) | Surrogate: Total Deltamethrin-d6 | | | % recovery | % recovery | | | | Organics | Pesticides | Pyrethroids | Insecticides | | |
| Demeton, Total | Total Demeton | 8065483 | | ug/L | mg/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-Ops | | | |
| Demeton-O | Demeton-O | 298033 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | | | | |
| Demeton-s | Demeton-s | 126750 | | ug/L | ug/Kg dw | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
| Density | Density of Sample | | | mg/cm3 | | | | | Habitat | | | | | |
| Deposits | Deposits | | none | | | | | | Habitat | | | | | |
| Desethyl-Atrazine | Desethyl-Atrazine | 6190654 | | ug/L | | | ng/g ww | ng/g dw | Organics | Pesticides | Pest-Triazines | | | |
| Desethyl-desisopropyl-atrazine | Desethyl-desisopropyl-atrazine | 3397624 | | ug/L | | | | | Organics | Pesticides | Pest-Triazines | | | |
| Desisopropyl-Atrazine | Desisopropyl-Atrazine | 1007289 | | ug/L | | | | | Organics | Pesticides | Pest-Triazines | | | |
| Desmethyl-LR | Desmethyl-LR | 120011667 | | ug/L | | | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
| Desmethyl-RR | Desmethyl-RR | | | ug/L | | | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
| Desmetryn | Desmetryn | 1014693 | | ug/L | | | | | Organics | Pesticides | Pest-Triazines | | | |
| Deuterium/Hydrogen Ratio | Deuterium/Hydrogen Ratio | 7782390 | | per mil | | | | | Isotopes | | | | | |
| Diazinon | Diazinon | 333415 | | ug/L | ug/Kg dw | | ug/g ww | ug/g dw | Organics | Pesticides | Pest-OPs | | | |
| Diazinon-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Diazinon-d10 | 100155473 | | | | | % recovery | % recovery | Organics | Pest-OPs | IDA | | | |
| Diazinon-D10(Surrogate) | Diazinon-D10(Surrogate) | | | % recovery | % recovery | | | | Organics | Pesticides | | | | |
| Diazoxon | Diazoxon | 962583 | | | | | ng/g ww | ng/g dw | Organics | Pesticides | OrganophosphatePest. | OrganochlorinePesticides | | |
| Dibenz(a,h)anthracene | Dibenz(a,h)anthracene | 53703 | | ug/L | ug/Kg dw | | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | | |
| dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene | dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene | | | | ng/g dw | | | | | | | | | |
| Dibenzofuran | Dibenzofuran | 132649 | | | | | ng/g ww | ng/g dw | Organics | SVOCs | Insecticides | | | |
| Dibenzothiophene | Dibenzothiophene | 132650 | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | | | |
| Dibenzothiophene-d8(Surrogate) | Surrogate: Dibenzothiophene-d8 | 33262292 | | % recovery | % recovery | | | | Organics | PAHs | SVOCs | | | |
| Dibenzothiophenes, C1- | C1-Dibenzothiophenes | | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | | | |
| Dibenzothiophenes, C2- | C2-Dibenzothiophenes | | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | | | |
| Dibenzothiophenes, C3- | C3-Dibenzothiophenes | | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | | | |
| Dibromo-3-Chloropropane, 1,2- | 1,2-Dibromo-3-Chloropropane (DBCP) | 96128 | | ug/L | | | | | Organics | VOCs | | | | |
| Dibromo-4-hydroxybenzonitrile, 3,5- | 3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil) | 1689845 | | ug/L | | | | | Organics | SVOCs | | | | |
| Dibromochloromethane | Dibromochloromethane | 124481 | | ug/L | | | | | Organics | VOCs | | | | |
| Dibromoethane, 1,2- | 1,2-Dibromoethane | 106934 | | ug/L | | | | | Organics | VOCs | Insecticides | | | |
| Dibromofluoromethane | Dibromofluoromethane | 1868537 | | ug/L | | | | | | | | | | |
| Dibromofluoromethane(Surrogate) | Surrogate: Dibromofluoromethane | 1868537 | | % recovery | | | | | Organics | VOCs | | | | |
| Dibromomethane | Dibromomethane | 74953 | | ug/L | | | | | Organics | VOCs | | | | |
| Dibromooctafluorobiphenyl, 4,4'-(Surrogate) | Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB) | 10386842 | | % recovery | % recovery | | % recovery | % recovery | Organics | Pesticides | Pest-OCHs | | | |
| Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608 | Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column DB-608 | 10386842 | | % recovery | % recovery | | | | Organics | Pesticides | Pest-OCHs | | | |
| Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5 | Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column HP-5 | 10386842 | | % recovery | % recovery | | | | Organics | Pesticides | Pest-OCHs | | | |
| Dibutylchlorendate(Surrogate) | Surrogate: Dibutylchlorendate (DBCE) | 1770805 | | % recovery | % recovery | | | | Organics | Pesticides | FlameRetardants | | | |
| Dibutyltin as Sn | Dibutyltin as Sn (DBT) | 1191486 | | ug/L | ng/g dw | | ng/g ww | ng/g dw | Organics | Organotins | Biocide | | | |
| Dicamba | Dicamba (2,5-Dichloro-6-methoxybenzoic Acid) | 1918009 | | ug/L | | | | | Organics | Herbicides | | | | |
| Dichlofenthion | Dichlofenthion | 97176 | | ug/L | ng/g dw | | ug/g ww | ug/g dw | Organics | Pesticides | Pest-OPs | Insecticides | Nematocides | |
| Dichlofenthion(Surrogate) | Surrogate: Dichlofenthion | | | % recovery | % recovery | | | | | | | | | |
| Dichlone | Dichlone | 117806 | | ug/L | | | | | Organics | Pesticides | Fungicides | | | |
| Dichloran | Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-) | 99309 | | ug/L | ng/g ww | | | | Organics | Pesticides | Fungicides | | | |
| Dichlorobenzene, 1,2- | 1,2-Dichlorobenzene | 95501 | | ug/L | | | | | Organics | VOCs | SVOCs | Herbicides | | |
| Dichlorobenzene, 1,3- | 1,3-Dichlorobenzene | 541731 | | ug/L | | | | | Organics | VOCs | SVOCs | Insecticides | | |
| Dichlorobenzene, 1,4- | 1,4-Dichlorobenzene | 106467 | | ug/L | | | | | Organics | VOCs | SVOCs | Insecticides | | |
| Dichlorobenzene-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichlorobenzene-d4 | 2199691 | | % recovery | | | | | Organics | VOCs | | | | |
| Dichlorobenzene-d4, 1,4-(Surrogate) | Surrogate: 1,4-Dichlorobenzene-d4 | 3855821 | | % recovery | | | | | Organics | VOCs | SVOCs | Insecticides | | |
| Dichlorodifluoromethane | Dichlorodifluoromethane | 75718 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichloroethane, 1,1- | 1,1-Dichloroethane | 75343 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichloroethane, 1,2- | 1,2-Dichloroethane | 107062 | | ug/L | | | | | Organics | VOCs | | Insecticides | | |
| Dichloroethane-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichloroethane-d4 | 17060070 | | % recovery | | | | | Organics | VOCs | | | | |
| Dichloroethylene, 1,1- | 1,1-Dichloroethylene (1,1-Dichloroethene) | 75354 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichloroethylene, cis 1,2- | cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene) | 156592 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichloroethylene, Total 1,2- | Total 1,2-Dichloroethylene | | | ug/L | | | | | | | | | | |
| Dichloroethylene, trans 1,2- | trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene) | 156605 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichlorophenoxyacetic Acid, 2,3-(Surrogate) | Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D) | 276741 | | % recovery | | | | | Organics | VOC | | | | |
| Dichlorophenoxyacetic Acid, 2,4- | 2,4-Dichlorophenoxyacetic Acid (2,4-D) | 94757 | | ug/L | | | | | Organics | Herbicides | | | | |
| Dichlorophenoxybutyric Acid Methyl Ester, 2,4- | 2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester) | | | ug/L | | | | | Organics | Herbicides | | | | |
| Dichlorophenoxybutyric Acid, 2,4- | 2,4-Dichlorophenoxybutyric Acid (2,4-DB) | 94826 | | ug/L | | | | | Organics | Herbicides | | | | |
| Dichlorophenylacetic Acid, 2,4- (Surrogate) | Surrogate: 2,4-Dichlorophenylacetic Acid | 19719289 | | % recovery | | | | | Organics | Herbicides | | | | |
| Dichloroprop | Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid) | 120365 | | ug/L | | | | | Organics | Herbicides | | | | |
| Dichloropropane, 1,2- | 1,2-Dichloropropane | 78875 | | ug/L | | | | | Organics | VOCs | Insecticides | Nematocides | | |
| Dichloropropane, 1,3- | 1,3-Dichloropropane | 142289 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichloropropane, 2,2- | 2,2-Dichloropropane | 594207 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichloropropene, 1,1- | 1,1-Dichloropropene | 563586 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichloropropene, cis 1,3- | cis-1,3-Dichloropropene | 10061015 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichloropropene, Total 1,3- | Total 1,3-Dichloropropene | | | ug/L | | | | | | | | | | |
| Dichloropropene, trans 1,3- | trans-1,3-Dichloropropene | 10061026 | | ug/L | | | | | Organics | VOCs | | | | |
| Dichloropropionic Acid, 2,2- | 2,2-Dichloropropionic Acid (Dalapon) | 75990 | | ug/L | | | | | Organics | Herbicides | | | | |
| Dichloro-pyridine-2-carboxylic Acid, 3,6- | 3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid) | 1702176 | | ug/L | | | | | Organics | Herbicides | | | | |
| Dichlorotrifluoroethane | Dichlorotrifluoroethane (Freon 123) | | | ug/L | | | | | | | | | | |
|